9 making a row of elements with a variable amount of content the same height
báo cáo khoa học: "Adult B lymphoblastic leukaemia/lymphoma with hypodiploidy (-9) and a novel chromosomal translocation t(7;12)(q22;p13) presenting with severe eosinophilia – case report and review of literature" pdf
... bone marrow transplantation from matched sibling/unrelated All authors were involved in management of the patient and preparation of this manuscript All authors read and approved the final manuscript ... Eosinophilia may antedate the development of acute lymphoblastic leukemia by several months to years, and the patients may present with urticarial lesions and other non-haematological features of hypereosnophilic ... chemotherapy regimen was repeated weeks after the end of the cycle, when hematopoeitic recovery was adequate and the patient was stable On 28th day of the intensification, the patient bone marrow...
- 6
- 351
- 0
Báo cáo y học: " Experiences of treatment decision making for young people diagnosed with depressive disorders: a qualitative study in primary care and specialist mental health settings BMC Psychiatry " pps
... (mean = 43.6 minutes) Page 14 of 47 Data analysis Analysis was undertaken in accordance with Braun and Clarke’s description of thematic analysis [53] The analysis was theoretically driven in that ... the amount of information shared between the healthcare provider and consumer The establishment of the International Patient Decision Aid Standards (IPDAS), means that the quality of DAs can now ... staff, clients and caregivers from Orygen Youth Health and headspace Barwon, and also Dr Barnaby Nelson and Dr Anita Williams for their assistance with the analysis and methodological approach...
- 49
- 297
- 0
Báo cáo y học: "The increase of plasma galectin-9 in a patient with insulin allergy: a case report" ppt
... the article, and SB and URS analyzed the data of OPN and Gal-9 Drs YA and HS analyzed clinical data TA and MH measured the levels of plasma galectin-9 TH is responsible for all the work All authors ... 2Department of Immunology and Immunopathology, Kagawa University, Takamatsu, Japan Page of 15 Cortegano I, del Pozo V, Cárdaba B, de Andrés B, Gallardo S, del Amo A, Arrieta I, Jurado A, Palomino ... Chagan-Yasutan et al Clinical and Molecular Allergy 2010, 8:12 http://www.clinicalmolecularallergy.com /content/ 8/1/12 Page of Table Laboratory data Variable Ref Range 30-Dec-08 13-Jan-09...
- 4
- 314
- 0
MAKING A CHART OF THE ENERGY CONSUMPTION IN H.C.M. CITY
... the group has to take part in their work going to each of the family in their neighbour to take the notes of the amount of energy they spent (water, electricity, ,oil,coal…) in a module of time ... for from many different areas (survey, geothermatics, environment, factories) in their websites and make the chart with their agreed result All groups present their ways to and their charts in ... front of the class and share the best way to the web site of the resources file of City education service ACTIVITIES All Ss.in each group should their real assignement to be able to collect the...
- 8
- 406
- 0
Time and performance a three part study examining the relationships of job experience, organizational tenure, and age with job performance
... year was associated with a decrease in the relationship with performance by 0.013 (p < 01) For age, an increase of one year of a sample’s age was associated with a decrease in the age/performance ... deviation of the temporal variable will be included later as a control variable in the tests with covariates Summary of Literature Searches There are many potential studies to include in a meta-analysis ... was approximated as job tenure; however, this was not always the case, and in two studies the mean experience of the sample was greater than the mean organizational tenure of the sample As the...
- 44
- 429
- 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA ... ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT GTACTTGCGCTCAGGAGGAG 178 246 ... BCRP CA9 BMP2 MT 2A CD237904 AL707095 AK095731 DKK1 BC037851 b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA...
- 13
- 563
- 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
... that the mechanism of release of the axial ligand under alkaline conditions and in the presence of GdmHCl is different Under alkaline conditions release of the axial ligand is postulated to arise ... resulting in the perturbation of a number of electronic absorption bands and the appearance in the spectrum of new ones One of these, a band at 623 nm, grows into the spectrum indicating a change from ... considerably longer than the above and suggesting a weaker interaction with the positive charge on the heme-iron It could be speculated that wat3, adjacent to the M100 ˚ ligand at a distance of 6.0 A...
- 15
- 509
- 0
Báo cáo khoa học: "Multilingual WSD with Just a Few Lines of Code: the BabelNet API" pdf
... lexical knowledge base, along the lines of Navigli and Lapata (2010) At its core, the API leverages an in-house Java library to query paths and create semantic graphs with BabelNet The latter ... (bn:02945246n) and E TH ICAL BANKING (bn:02854884n, from Italian) An API for multilingual WSD BabelNet API BabelNet can be effectively accessed and automatically embedded within applications by means of a ... Thanks to carefully designed Java classes, we are able to accomplish all of this in about 20 lines of code Multilingual WSD API We use the BabelNet API as a framework to build a toolkit that allows...
- 6
- 400
- 0
Báo cáo Y học: Domain V of m-calpain shows the potential to form an oblique-orientated a-helix, which may modulate the enzyme’s activity via interactions with anionic lipid potx
... interact with membrane via the formation of an oblique-orientated a- helix [26], a class of a- helices [29– 35] that penetrate membranes at a shallow angle because of a hydrophobicity gradient along ... hydrophobicity gradient along the a- helical long axis [27,28] It was suggested by Daman et al [26] that the formation of such an a- helix may feature in the membrane interactions of m-calpain domain V Here, ... window The software was also used to represent both this sequence and that of HA2 as two-dimensional axial projections assuming an angular periodicity of 100 ° (Fig 3) Haemolytic assay of VP1 Haemolytic...
- 9
- 392
- 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf
... PCR amplification of the Hsp9 0a ORF using the forward primer AAATAAGTCG ACATGCCTGAGGAAACCCAG (SalI site underlined; Hsp9 0a start codon in bold) and the reverse primer CTTC ATCTGCAGTTAGTCTACTTCTTCCAT ... primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse primer CA GTAGCTTCATCTTTCGATCGACTTCTTCCATGCGA GA) The second PCR used a ... loss of any actin organization following Hsp90 inhibitor treatment; data not shown) After h, many of these cells displayed an apparent arrest of DNA and vacuolar segregation between the mother and...
- 11
- 427
- 0
Báo cáo khoa học: IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain pdf
... EcoRI-T7-aaaaaatccaaaaaaaatct-BamHI EcoRI-T7-tctaaaaaaatcttttaaaaaacccc-BamHI EcoRI-T7-ccccaaaaaaatttacaaaaaatc-BamHI EcoRI-T7-ccccaaaaaaattt-BamHI EcoRI-T7-aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaa-BamHI ... create various ARS constructs Primer Sense sequence ARS EcoRI-T7-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaa ccccaaaaaaatttacaaaaaa-BamHI EcoRI-T7-tccaaaaaaaatctaaaaaaatcttttaaaaaa ccccaaaaaaattt-BamHI ... EarI-catgggacgatttaagtct EarI-catggaacagatgaaacaa EarI-catggagcgccaggctcac EarI-catgaacaagctttacatcg EarI-catggtggacatcccccttcgg EarI-catggctgctccctatagctcc KpnI-ttaaacagttggaacaccgg KpnI-ttagcctactccacttttgcg...
- 13
- 466
- 0
making sense of online learning a guide for beginners and the truly skeptical
... and retrain people mean the need to teach and learn at a distance will escalate Some of the main benefits of online learning (a form of distance learning) are flexibility (people can learn at any ... for example—were text-based because books and paper were the technology that was available at the time As technologies change and expand, the options for learning expand with them Because the Internet ... to large groups of learners regardless of location • Enhanced communication and collaboration Certain software tools allow learners to communicate with each other, collaborate on projects, and...
- 187
- 415
- 0
C H A P T E R 35 P Types of Poems Poetry POETRY SHARES many of the same elements as fiction, but doc
... narrator and Tante Atie? a They are sisters b They are friends c Tante Atie is the narrator’s guardian d Tante Atie is the narrator’s mother b Tante Atie is the narrator’s teacher 27 What is happening ... from grace This fall usually happens because of the character’s tragic flaw (though the character often tries to blame fate) A tragic flaw is a characteristic that drives the character to make a poor ... dead and I hated jackdaws I’d be a man someday and I’d come back with a bag of rocks and I’d leave the graveyard littered with dead jackdaws Commentar y on the Arts The purpose of commentary is to...
- 48
- 572
- 0
báo cáo hóa học: " A decision support framework for the discrimination of children with controlled epilepsy based on EEG analysis" pdf
... select Theta-Alpha band activity on central and temporal channels (TL, TR, CL and CR) for further analysis of our results from univariate analysis In Table we analyze the spectral biomarkers of the ... in the Theta and Alpha bands, as well as a symmetrical energy variation pattern in Delta, Theta, Alpha and Beta bands This result is in line with earlier studies [19,30], which found an increase ... the Beta band over the frontal lobe For the Gamma bands, WT also obtained relatively stable scores over the parietal and occipital brain areas, but as shown in the topographic maps earlier, the...
- 14
- 454
- 0
báo cáo hóa học: " A radial basis classifier for the automatic detection of aspiration in children with dysphagia" doc
... classifying a vibration signal as an aspiration when a swallow has actually occurred, whereas a false negative (FN) is the event of classifying a vibration signal as a swallow when an aspiration has actually ... below Stationarity Weak stationarity implies that the mean and variance of the signal not change over time Determination of stationarity is important in selecting the appropriate analytical method, ... prior to each child's participation The protocol was approved by the Research Ethics Board of Bloorview Kids Rehab (Canada) The mean age of the participants was 6.0 ± 3.9 years with 64 males and 53...
- 17
- 497
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25